Coxiella burnetii Dugway 5J108-111: CBUD_2037 Help Entry CBUD_2037         CDS       T00583                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism cbd  Coxiella burnetii Dugway 5J108-111 Brite KEGG Orthology (KO) [BR:cbd00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:cbd03036]     CBUD_2037 Chromosome and associated proteins [BR:cbd03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     CBUD_2037 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Herpes_BLRF2 Sec5 GldM_1st ZapB ADIP YabA Seryl_tRNA_N Nup188_C Sas6_CC Sas-6_C_CC FapA CLZ Motif Other DBs NCBI-ProteinID:  ABS76581 UniProt:  A9KGV6 LinkDB All DBs Position 2012931..2013170 Genome browser AA seq 79 aa AA seqDB search MKIIKRISRMQPTHTLELSELEYQVDHLLRSLERLKSENNALRQKLATQVRERSLLVEKN LQAAQKIKKVITQLREEMP NT seq 240 nt NT seq  +upstreamnt  +downstreamnt ttgaaaataataaaaaggatatcaaggatgcaacctacacatacgctagaactcagcgag ttagaatatcaagttgatcatttattgcgttctttagaacgattgaaatcggaaaacaat gcgttgcgtcaaaaattagccactcaagtccgggagcgttcattattggttgaaaaaaac cttcaagccgcccagaaaattaaaaaagtaattacacaattaagggaagaaatgccatga

DBGET integrated database retrieval system