Caenorhabditis briggsae (nematode): CBG_01590 Help Entry CBG_01590         CDS       T01054                                  Name (RefSeq) Protein CBG01590   KO K15360   centromere protein X Organism cbr  Caenorhabditis briggsae (nematode) Pathway cbr03460   Fanconi anemia pathway Brite KEGG Orthology (KO) [BR:cbr00001]  09120 Genetic Information Processing   09124 Replication and repair    03460 Fanconi anemia pathway     CBG_01590  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03400 DNA repair and recombination proteins [BR:cbr03400]     CBG_01590 DNA repair and recombination proteins [BR:cbr03400]  Eukaryotic type   DSBR (double strand breaks repair)    FA (Fanconi anemia) pathway     FA core complex binding factors      CBG_01590 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CENP-X Synuclein DUF3349 Motif Other DBs NCBI-GeneID:  8576046 NCBI-ProteinID:  XP_002634051 WormBase:  CBG01590 UniProt:  A0AAE9AAG8 A8WRA8 LinkDB All DBs Position IV:complement(11202473..11202761) Genome browser AA seq 79 aa AA seqDB search MTMHIKQSTVRSILTVARRGKKRLNLDSDALAVLTALINLLAQETIARTCQTAANTGDRH VTRDHLKRIIAQIMLDFAV NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atgacaatgcacatcaagcagtcaacagtaagatcaattcttacagtagctcgacgtgga aagaaacgactgaatttggattcagatgctttagcagttctcacagcactcatcaattta cttgcacaagaaacaatcgctaggacatgccagacggcagccaatacaggcgatcgtcac gtgacaagagatcatctcaaacggataattgcccaaatcatgctcgatttcgcagtttaa

DBGET integrated database retrieval system