Coxiella burnetii RSA 493: CBU_0068 Help Entry CBU_0068          CDS       T00124                                  Name (RefSeq) hypothetical protein   KO K09892   cell division protein ZapB Organism cbu  Coxiella burnetii RSA 493 Brite KEGG Orthology (KO) [BR:cbu00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:cbu03036]     CBU_0068 Chromosome and associated proteins [BR:cbu03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     CBU_0068 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Herpes_BLRF2 Sec5 GldM_1st ZapB ADIP YabA Seryl_tRNA_N Nup188_C Sas6_CC Sas-6_C_CC FapA CLZ Motif Other DBs NCBI-GeneID:  1207938 NCBI-ProteinID:  NP_819121 UniProt:  Q83F80 LinkDB All DBs Position complement(62755..62994) Genome browser AA seq 79 aa AA seqDB search MKIIKRISRMQPTHTLELSELEYQVDHLLRSLERLKSENNALRQKLATQVRERSLLVEKN LQAAQKIKKVITQLREEMP NT seq 240 nt NT seq  +upstreamnt  +downstreamnt ttgaaaataataaaaaggatatcaaggatgcaacctacacatacgctagaactcagcgag ttagaatatcaagttgatcatttattgcgttctttagaacgattgaaatcggaaaacaat gcgttgcgtcaaaaattagccactcaagtccgggagcgttcattattggttgaaaaaaac cttcaagccgcccagaaaattaaaaaagtaattacacaattaagggaagaaatgccatga

DBGET integrated database retrieval system