Conger conger (European conger): 133132113 Help Entry 133132113         CDS       T10633                                  Symbol dynll2b Name (RefSeq) dynein, light chain, LC8-type 2b   KO K10418   dynein light chain LC8-type Organism ccog  Conger conger (European conger) Pathway ccog04814   Motor proteins ccog05132   Salmonella infection Brite Cilium and associated proteins [BR:ccog03037]  Motile cilia and associated proteins   Dynein arm    133132113 (dynll2b) Cytoskeleton proteins [BR:ccog04812]  Eukaryotic cytoskeleton proteins   Microtubules    Tubulin-binding proteins     Dyneins      133132113 (dynll2b) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  133132113 NCBI-ProteinID:  XP_061103269 LinkDB All DBs Position 7:32210725..32218577 Genome browser AA seq 89 aa AA seqDB search MADRKAVIKNADMSEDMQQDAVDCATQAMEKFNIEKDIAAYIKKEFDKKYNPTWHCIVGR NFGSYVTHETKHFIYFYLGQVAILLFKSG NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atggctgacaggaaggctgtgatcaagaatgctgacatgtccgaggacatgcagcaggat gctgtggactgtgccacccaggccatggagaagttcaacatcgagaaagatatcgctgca tacattaagaaggagtttgacaagaagtacaatcccacatggcattgcattgtgggaagg aacttcgggagctacgtaacgcatgagacaaagcacttcatctacttctacctggggcaa gtggccatcctgctcttcaagtctggctga

DBGET integrated database retrieval system