Corallococcus coralloides: COCOR_02627 Help Entry COCOR_02627       CDS       T01780                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism ccx  Corallococcus coralloides Pathway ccx01100   Metabolic pathways ccx01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:ccx00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     COCOR_02627 (acpP)    00074 Mycolic acid biosynthesis     COCOR_02627 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     COCOR_02627 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 Ribosomal_L12_N MAP Motif Other DBs NCBI-ProteinID:  AFE07957 UniProt:  H8MTT6 LinkDB All DBs Position 3267154..3267402 Genome browser AA seq 82 aa AA seqDB search MSTTATDVETKIKSIIADQLGVGEDEIKPESSFIEDLGADSLDIVELVMAMEEEFEVEIP DDEAENIKTVGDAVNYVKTHKK NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atgtccaccaccgcaaccgacgtggaaaccaagatcaagtccatcatcgccgaccagctc ggtgtgggtgaggatgagatcaagcctgagtcgtccttcatcgaagacctgggcgcggac agcctcgacatcgtcgagctggtcatggcgatggaagaggagttcgaggtcgagattccg gatgacgaggcggagaacatcaagaccgtcggcgacgccgtgaactacgtgaagacccac aagaagtag

DBGET integrated database retrieval system