Corynebacterium efficiens: CE2148 Help Entry CE2148            CDS       T00103                                  Name (GenBank) putative acyl carrier protein   KO K02078   acyl carrier protein Organism cef  Corynebacterium efficiens Pathway cef00998   Biosynthesis of various antibiotics cef01100   Metabolic pathways cef01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:cef00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     CE2148    00074 Mycolic acid biosynthesis     CE2148   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     CE2148 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  PP-binding PP-binding_2 POTRA-like Motif Other DBs NCBI-ProteinID:  BAC18959 UniProt:  Q8FNJ5 LinkDB All DBs Position 2284359..2284652 Genome browser AA seq 97 aa AA seqDB search MIPNSTNTPETPDDARTGMLTTLVGILSDVGGVSAEDITTTARLREDLAISSLNLIEAVV RVEDAFGVRIEDADVQGFTTTGDIVDFLEANRSETVT NT seq 294 nt NT seq  +upstreamnt  +downstreamnt atgatcccgaactccaccaatacccctgaaacccccgatgacgcccggacgggcatgctc accaccctggtcgggatcctgtcggatgtgggtggggtgagtgccgaggacatcaccacc accgcccgcctgcgcgaggacctggccatcagctccctcaacctcatcgaggctgtcgtg cgggtggaggatgctttcggggtgcgcatcgaggatgctgatgtacagggattcaccacc accggtgacatcgttgatttcctggaggccaaccgttcggaaacagtgacctaa

DBGET integrated database retrieval system