Cellvibrio sp. KY-GH-1: D0C16_15115 Help Entry D0C16_15115       CDS       T06422                                  Name (GenBank) TIGR02449 family protein   KO K09892   cell division protein ZapB Organism ceg  Cellvibrio sp. KY-GH-1 Brite KEGG Orthology (KO) [BR:ceg00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:ceg03036]     D0C16_15115 Chromosome and associated proteins [BR:ceg03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     D0C16_15115 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB Motif Other DBs NCBI-ProteinID:  QEY17192 UniProt:  A0A5J6PE54 LinkDB All DBs Position 3515830..3516036 Genome browser AA seq 68 aa AA seqDB search MSDDLLLALETKLDKLILLCNRLQQENADLKARESEWQRERVRLIEKNELARSRVEAMIT HLRNLDAE NT seq 207 nt NT seq  +upstreamnt  +downstreamnt atgtctgacgatcttttactcgccctggaaaccaagctggataagctgatcctgttgtgc aatcgcttgcaacaagaaaatgctgacttaaaggcccgcgaaagtgaatggcagcgcgag cgagtgcgcctgattgaaaagaatgagctcgcccgcagccgtgtagaggccatgatcacc catttacgcaatctggatgccgaataa

DBGET integrated database retrieval system