Cellulomonas sp. ES6: P9841_13120 Help Entry P9841_13120       CDS       T10432                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism cele  Cellulomonas sp. ES6 Pathway cele01100   Metabolic pathways cele01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:cele00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     P9841_13120    00074 Mycolic acid biosynthesis     P9841_13120   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     P9841_13120 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Homoserine_dh Motif Other DBs NCBI-ProteinID:  WHP16552 LinkDB All DBs Position complement(2824643..2824882) Genome browser AA seq 79 aa AA seqDB search MPTTEDQVHDVIRDVLLQPDLQLTDTTTAGDVEGWDSLAHISILFSLESAFGIRFADAEM GSIQNVGELVTLIQAKTGT NT seq 240 nt NT seq  +upstreamnt  +downstreamnt gtgcccaccaccgaggaccaggtccacgacgtcatccgcgacgtcctcctccagcccgac ctgcagctcaccgacaccaccaccgccggagacgtggagggctgggactccctcgcgcac atcagcatcctgttctccctggagtccgcgttcgggatccggttcgccgacgccgagatg ggctccatccagaacgtcggcgagctggtcaccctgatccaggccaagaccgggacctga

DBGET integrated database retrieval system