Cellvibrio sp. PSBB006: CBR65_11715 Help Entry CBR65_11715       CDS       T04891                                  Name (GenBank) TIGR02449 family protein   KO K09892   cell division protein ZapB Organism cell  Cellvibrio sp. PSBB006 Brite KEGG Orthology (KO) [BR:cell00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:cell03036]     CBR65_11715 Chromosome and associated proteins [BR:cell03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     CBR65_11715 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB Motif Other DBs NCBI-ProteinID:  ARU28040 UniProt:  A0A1Y0FXA8 LinkDB All DBs Position 2801709..2801915 Genome browser AA seq 68 aa AA seqDB search MSDDLLLSLETKLDRLILLCNRLQQENAQLKAREGEWQRERERLIEKNELARSRVEAMIA HLKSLDAE NT seq 207 nt NT seq  +upstreamnt  +downstreamnt atgtctgacgaccttctactctcattggaaaccaagctggatcgcttgattctgctgtgc aaccgcctgcaacaggaaaatgcacagctgaaagcgcgcgaaggtgaatggcagcgtgag cgcgaacgactgatcgagaagaatgaactggcccgcagccgggtggaagccatgatcgcc cacctgaaaagtctggatgcggaataa

DBGET integrated database retrieval system