Comamonas endophytica: M9799_00055 Help Entry M9799_00055       CDS       T09983                                  Name (GenBank) cell division protein ZapB   KO K09892   cell division protein ZapB Organism cenp  Comamonas endophytica Brite KEGG Orthology (KO) [BR:cenp00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:cenp03036]     M9799_00055 Chromosome and associated proteins [BR:cenp03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     M9799_00055 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB DUF4164 Cep57_CLD_2 CENPH CC_Bre1 Taxilin CCDC106 DivIVA YabA DivIC Motif Other DBs NCBI-ProteinID:  UYG51696 UniProt:  A0ABY6GCM1 LinkDB All DBs Position 10269..10484 Genome browser AA seq 71 aa AA seqDB search MSAPSPLDLISDRVERLLLRHEELQRTNALLAEQVAALTQERDSLRSRLSAARARVDALI ERLPSNEKAGT NT seq 216 nt NT seq  +upstreamnt  +downstreamnt atgtctgccccgtcccccctcgacctcatatccgaccgcgtggagcgacttctgttgcgc cacgaggagcttcagcgcaccaatgccctgctggccgaacaggtcgcggccctgacccag gaacgcgattcgctgcgctcgcggctgagcgccgcgcgtgcccgtgtcgatgccctgatc gagcgcctgcccagcaatgaaaaggccggcacatga

DBGET integrated database retrieval system