Corallococcus exiguus: ACN6A2_03560 Help Entry ACN6A2_03560      CDS       T11255                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism cexi  Corallococcus exiguus Pathway cexi00998   Biosynthesis of various antibiotics cexi01100   Metabolic pathways cexi01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:cexi00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     ACN6A2_03560 (acpP)    00074 Mycolic acid biosynthesis     ACN6A2_03560 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     ACN6A2_03560 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 Ribosomal_L12_N MAP Motif Other DBs NCBI-ProteinID:  XWU94401 LinkDB All DBs Position complement(885522..885770) Genome browser AA seq 82 aa AA seqDB search MSTTATDVETKIKSIIADQLGVGEDEIKPESSFIEDLGADSLDIVELVMAMEEEFEVEIP DDEAENIKTVGDAVNYVKTHKK NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atgtccaccaccgcaaccgacgtggaaaccaagatcaagtccatcatcgccgaccagctc ggtgtgggtgaggatgagatcaagcccgagtcgtccttcatcgaagacctgggcgcggac agcctcgacatcgtcgagctggtcatggcgatggaagaggagttcgaggtcgagattccg gatgacgaggcggagaacatcaagaccgtcggcgacgccgtgaactacgtgaagacccac aagaagtag

DBGET integrated database retrieval system