Canis lupus familiaris (dog): 100886079 Help Entry 100886079         miRNA     T01007                                  Symbol MIR29B-1 Name (RefSeq) cfa-miR-29b   KO K16995   microRNA 29 Organism cfa  Canis lupus familiaris (dog) Pathway cfa05206   MicroRNAs in cancer cfa05207   Chemical carcinogenesis - receptor activation Brite KEGG Orthology (KO) [BR:cfa00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100886079 (MIR29B-1)    05207 Chemical carcinogenesis - receptor activation     100886079 (MIR29B-1)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:cfa04147]     100886079 (MIR29B-1)   09184 RNA family    03100 Non-coding RNAs [BR:cfa03100]     100886079 (MIR29B-1) Exosome [BR:cfa04147]  Exosomal RNA   Exosomal RNA of breast milk    100886079 (MIR29B-1)   Exosomal RNA of saliva    100886079 (MIR29B-1)   Exosomal RNA of hepatic cancer cells    100886079 (MIR29B-1)   Exosomal RNA of renal carcinoma cells    100886079 (MIR29B-1)   Exosomal RNA of lung cancer cells    100886079 (MIR29B-1) Non-coding RNAs [BR:cfa03100]  Other eukaryotic RNA   Micro RNA    100886079 (MIR29B-1) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100886079 Ensembl:  ENSCAFG00000020463 miRBase:  MI0008021 LinkDB All DBs Position 14:5844727..5844791 Genome browser NT seq 23 nt NT seq  +upstreamnt  +downstreamnt tagcaccatttgaaatcagtgtt

DBGET integrated database retrieval system