Cystobacter fuscus: CYFUS_003471 Help Entry CYFUS_003471      CDS       T05065                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism cfus  Cystobacter fuscus Pathway cfus01100   Metabolic pathways cfus01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:cfus00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     CYFUS_003471    00074 Mycolic acid biosynthesis     CYFUS_003471   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     CYFUS_003471 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C MAP DUF1493 Motif Other DBs NCBI-ProteinID:  ATB38045 UniProt:  A0A250J240 LinkDB All DBs Position 4266298..4266540 Genome browser AA seq 80 aa AA seqDB search MSTSAIEAKVKSIIADQLGVGEEEIKPESSFIEDLGADSLDIVELVMAMEEEFEVEIPDE EAENIKTVGDAINYVNTHKK NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgtcgacttctgctatcgaggccaaggtcaagtccatcatcgccgaccagctgggcgtg ggcgaggaggagatcaagcccgagtcctccttcatcgaagatctgggcgccgacagcctc gacatcgtggaactggtcatggcgatggaggaggagttcgaggtcgagattcccgacgag gaggccgagaacatcaagaccgtcggcgacgccatcaactacgtcaacacccacaagaag tag

DBGET integrated database retrieval system