Campylobacter fetus subsp. venerealis cfvi03/293: CFVI03293_0142
Help
Entry
CFVI03293_0142 tRNA
T03000
Name
(GenBank) tRNA-Ser
KO
K14233
tRNA Ser
Organism
cfv
Campylobacter fetus subsp. venerealis cfvi03/293
Pathway
cfv00970
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:
cfv00001
]
09120 Genetic Information Processing
09122 Translation
00970 Aminoacyl-tRNA biosynthesis
CFVI03293_0142
09180 Brite Hierarchies
09184 RNA family
03100 Non-coding RNAs [BR:
cfv03100
]
CFVI03293_0142
Non-coding RNAs [BR:
cfv03100
]
Transfer RNA
CFVI03293_0142
BRITE hierarchy
SSDB
Ortholog
Paralog
Gene cluster
GFIT
LinkDB
All DBs
Position
complement(122724..122808)
Genome browser
NT seq
85 nt
NT seq
+upstream
nt +downstream
nt
ggatagatgtccgagcggctgaaggagcatgcctggaacgcgtgtaaagtgtaagctttc
gagggttcaaatccctctctgtccg
DBGET
integrated database retrieval system