KEGG   Campylobacter fetus subsp. venerealis cfvi03/293: CFVI03293_1705
Entry
CFVI03293_1705    tRNA      T03000                                 
Name
(GenBank) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
cfv  Campylobacter fetus subsp. venerealis cfvi03/293
Pathway
cfv00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:cfv00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    CFVI03293_1705
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:cfv03100]
    CFVI03293_1705
Non-coding RNAs [BR:cfv03100]
 Transfer RNA
  CFVI03293_1705
SSDB
LinkDB
Position
complement(1707532..1707605)
NT seq 74 nt   +upstreamnt  +downstreamnt
gcgctcatagctcagctggatagagcaacggccttctaagccgtaggccagaggttcgaa
tcctcttgggcgta

DBGET integrated database retrieval system