Cohnella herbarum: HH215_19830 Help Entry HH215_19830       CDS       T08421                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism cheb  Cohnella herbarum Pathway cheb00998   Biosynthesis of various antibiotics cheb01100   Metabolic pathways cheb01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:cheb00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     HH215_19830    00074 Mycolic acid biosynthesis     HH215_19830   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     HH215_19830 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 Motif Other DBs NCBI-ProteinID:  QJD88246 UniProt:  A0A7Z2VS82 LinkDB All DBs Position complement(4649610..4649804) Genome browser AA seq 64 aa AA seqDB search MFEESGRQQISSIESSMHLRDDLNMDSLMLAELTVRIEAEFEVDIFENVIVQTIGEIISQ IEGK NT seq 195 nt NT seq  +upstreamnt  +downstreamnt atgttcgaggagtccggcagacaacaaataagcagcatagaaagttcaatgcatttaaga gacgacttaaacatggattctcttatgttagccgagttaacggttcggatcgaagcagag tttgaagtcgatattttcgagaacgtcattgtacagacgatcggggagatcatttcgcag attgaagggaaataa

DBGET integrated database retrieval system