Corynebacterium hindlerae: J5O04_10175 Help Entry J5O04_10175       CDS       T08794                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism chin  Corynebacterium hindlerae Pathway chin00998   Biosynthesis of various antibiotics chin01100   Metabolic pathways chin01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:chin00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     J5O04_10175    00074 Mycolic acid biosynthesis     J5O04_10175   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     J5O04_10175 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  QTH59165 LinkDB All DBs Position 2122873..2123121 Genome browser AA seq 82 aa AA seqDB search MSDSQSTFTTLRNIIVESTGYDPDDVSLESNIVSDLAVDSLSIVEIAVRAEDAFGVYIGD KDAAGFTTVGDFVTFIDEHRES NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atgtctgactctcagagtacgttcactacgcttcgcaacatcatcgttgaaagcactgga tatgaccctgacgatgtctccctcgagtccaacatcgtctccgacctcgcggtggattct ctctccattgtagagatcgcggtccgcgccgaggacgccttcggagtgtacatcggagat aaggacgcagcaggctttacgacggtcggggacttcgtcacttttatcgacgaacatcgc gaaagttag

DBGET integrated database retrieval system