Chromobacterium phragmitis IIBBL 274-1: DK843_07495 Help Entry DK843_07495       CDS       T05744                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism chrb  Chromobacterium phragmitis IIBBL 274-1 Pathway chrb01100   Metabolic pathways chrb01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:chrb00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     DK843_07495    00074 Mycolic acid biosynthesis     DK843_07495   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     DK843_07495 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1896 Ribosomal_L50 DUF5783 DUF1493 Motif Other DBs NCBI-ProteinID:  AXE34158 UniProt:  A0A344UFW0 LinkDB All DBs Position complement(1548465..1548704) Genome browser AA seq 79 aa AA seqDB search MENIEARVKKIVAEQLGVNEAEIKVESSFVDDLGADSLDTVELVMALEEEFECEIPDEEA EKITTVQQAIDYVTGHLNK NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggaaaacatcgaagcgcgcgtcaagaagatcgttgccgagcaactgggcgtgaacgaa gccgaaatcaaggtggaaagctctttcgttgacgatctgggcgccgattccctggatacc gttgagctggtgatggctctggaagaagagttcgagtgcgaaattccggacgaagaggcc gagaagatcaccaccgttcagcaagccatcgactacgtgaccggccatctgaacaagtaa

DBGET integrated database retrieval system