Chromobacterium phragmitis IIBBL 112-1: DK842_04390 Help Entry DK842_04390       CDS       T05549                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism chri  Chromobacterium phragmitis IIBBL 112-1 Brite KEGG Orthology (KO) [BR:chri00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:chri03032]     DK842_04390    03036 Chromosome and associated proteins [BR:chri03036]     DK842_04390    03400 DNA repair and recombination proteins [BR:chri03400]     DK842_04390 DNA replication proteins [BR:chri03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     DK842_04390 Chromosome and associated proteins [BR:chri03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     DK842_04390 DNA repair and recombination proteins [BR:chri03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       DK842_04390 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG Motif Other DBs NCBI-ProteinID:  AXE29219 UniProt:  A0A344UH28 LinkDB All DBs Position 883444..883713 Genome browser AA seq 89 aa AA seqDB search MTKAELIALLSDKSGLTKADVLRVLGAFDDVLLDTLASNGEISIVAGKFKVKESAARTGR NPKTGETIQIAAKRKVSFVASKQLKDRIA NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atgaccaaagccgaactgattgcccttctctccgacaagtccggcctgaccaaagccgac gtgctgcgtgtgctgggcgctttcgacgacgtactgctggacaccctggccagcaacggc gagatcagcatcgtggccggcaaattcaaggtgaaggaaagcgccgcccgcaccggccgc aatccgaaaaccggcgagaccatccagattgccgccaagcgcaaggtttctttcgtcgcc agcaaacagctgaaagaccgcatcgcctga

DBGET integrated database retrieval system