Chromobacterium paludis: FYK34_11490 Help Entry FYK34_11490       CDS       T06224                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism chrm  Chromobacterium paludis Pathway chrm01100   Metabolic pathways chrm01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:chrm00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     FYK34_11490 (acpP)    00074 Mycolic acid biosynthesis     FYK34_11490 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     FYK34_11490 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1896 Ribosomal_L50 DUF5783 Motif Other DBs NCBI-ProteinID:  QEL56138 UniProt:  A0A5C1DK53 LinkDB All DBs Position complement(2472947..2473186) Genome browser AA seq 79 aa AA seqDB search MENIEARVKKIVAEQLGVNEAEVKIESSFVDDLGADSLDTVELVMALEEEFECEIPDEEA EKITTVQQAVDYVTAHLNK NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggaaaacatcgaagcgcgcgtgaagaagatcgtcgccgagcaactgggcgtgaacgaa gccgaagtgaagatcgaatcttccttcgtggacgatctgggcgccgactcgctcgacacc gttgagctggtaatggctctggaagaagagttcgagtgcgaaattccggacgaagaggcc gagaagatcacgaccgttcagcaagccgttgactacgtcaccgctcacctgaacaagtaa

DBGET integrated database retrieval system