Capra hircus (goat): 104795730 Help Entry 104795730         miRNA     T02910                                  Symbol MIR140 Name (RefSeq) chi-miR-140-5p   KO K17145   microRNA 140 Organism chx  Capra hircus (goat) Brite KEGG Orthology (KO) [BR:chx00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:chx04147]     104795730 (MIR140)   09184 RNA family    03100 Non-coding RNAs [BR:chx03100]     104795730 (MIR140) Exosome [BR:chx04147]  Exosomal RNA   Exosomal RNA of ovarian cancer cells    104795730 (MIR140)   Exosomal RNA of renal carcinoma cells    104795730 (MIR140) Non-coding RNAs [BR:chx03100]  Other eukaryotic RNA   Micro RNA    104795730 (MIR140) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  104795730 miRBase:  MI0030627 LinkDB All DBs Position 18:38226917..38227030 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt cagtggttttaccctatggtag

DBGET integrated database retrieval system