Capra hircus (goat): 104795770 Help Entry 104795770         miRNA     T02910                                  Symbol MIR21 Name (RefSeq) chi-miR-21-5p   KO K16863   microRNA 21 Organism chx  Capra hircus (goat) Pathway chx05205   Proteoglycans in cancer chx05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:chx00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     104795770 (MIR21)    05205 Proteoglycans in cancer     104795770 (MIR21)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:chx04147]     104795770 (MIR21)   09184 RNA family    03100 Non-coding RNAs [BR:chx03100]     104795770 (MIR21) Exosome [BR:chx04147]  Exosomal RNA   Exosomal RNA of breast milk    104795770 (MIR21)   Exosomal RNA of ovarian cancer cells    104795770 (MIR21)   Exosomal RNA of lung cancer cells    104795770 (MIR21)   Exosomal RNA of other cancer cells    104795770 (MIR21) Non-coding RNAs [BR:chx03100]  Other eukaryotic RNA   Micro RNA    104795770 (MIR21) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  104795770 miRBase:  MI0030691 LinkDB All DBs Position 19:10431004..10431026 Genome browser NT seq 23 nt NT seq  +upstreamnt  +downstreamnt tagcttatcagactgatgttgac

DBGET integrated database retrieval system