Capra hircus (goat): 104795771 Help Entry 104795771         miRNA     T02910                                  Symbol MIR216B Name (RefSeq) chi-miR-216b   KO K17124   microRNA 216 Organism chx  Capra hircus (goat) Brite KEGG Orthology (KO) [BR:chx00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:chx04147]     104795771 (MIR216B)   09184 RNA family    03100 Non-coding RNAs [BR:chx03100]     104795771 (MIR216B) Exosome [BR:chx04147]  Exosomal RNA   Exosomal RNA of pancreatic cells    104795771 (MIR216B) Non-coding RNAs [BR:chx03100]  Other eukaryotic RNA   Micro RNA    104795771 (MIR216B) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  104795771 miRBase:  MI0030692 LinkDB All DBs Position 11:complement(38251658..38251680) Genome browser NT seq 23 nt NT seq  +upstreamnt  +downstreamnt aaatctctgcaggcaaatgtgat

DBGET integrated database retrieval system