Capra hircus (goat): 104795833 Help Entry 104795833         miRNA     T02910                                  Symbol MIR424 Name (RefSeq) chi-miR-424-5p   KO K16992   microRNA 424 Organism chx  Capra hircus (goat) Brite KEGG Orthology (KO) [BR:chx00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:chx04147]     104795833 (MIR424)   09184 RNA family    03100 Non-coding RNAs [BR:chx03100]     104795833 (MIR424) Exosome [BR:chx04147]  Exosomal RNA   Exosomal RNA of breast milk    104795833 (MIR424) Non-coding RNAs [BR:chx03100]  Other eukaryotic RNA   Micro RNA    104795833 (MIR424) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  104795833 miRBase:  MI0030789 LinkDB All DBs Position X Genome browser NT seq 21 nt NT seq  +upstreamnt  +downstreamnt cagcagcaattcatgttttga

DBGET integrated database retrieval system