Capra hircus (goat): 104795841 Help Entry 104795841         miRNA     T02910                                  Symbol MIR483 Name (RefSeq) chi-miR-483   KO K17137   microRNA 483 Organism chx  Capra hircus (goat) Pathway chx05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:chx00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     104795841 (MIR483)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:chx04147]     104795841 (MIR483)   09184 RNA family    03100 Non-coding RNAs [BR:chx03100]     104795841 (MIR483) Exosome [BR:chx04147]  Exosomal RNA   Exosomal RNA of saliva    104795841 (MIR483)   Exosomal RNA of ovarian cancer cells    104795841 (MIR483)   Exosomal RNA of hepatic cancer cells    104795841 (MIR483)   Exosomal RNA of lung cancer cells    104795841 (MIR483) Non-coding RNAs [BR:chx03100]  Other eukaryotic RNA   Micro RNA    104795841 (MIR483) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  104795841 miRBase:  MI0030801 LinkDB All DBs Position 29:50436652..50436719 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt cactcctctcctcccgtcttct

DBGET integrated database retrieval system