Capra hircus (goat): 104797235 Help Entry 104797235         miRNA     T02910                                  Symbol MIR107 Name (RefSeq) chi-miR-107-3p   KO K17396   microRNA 107 Organism chx  Capra hircus (goat) Pathway chx05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:chx00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     104797235 (MIR107)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:chx04147]     104797235 (MIR107)   09184 RNA family    03100 Non-coding RNAs [BR:chx03100]     104797235 (MIR107) Exosome [BR:chx04147]  Exosomal RNA   Exosomal RNA of haemopoietic cells    104797235 (MIR107)   Exosomal RNA of ovarian cancer cells    104797235 (MIR107) Non-coding RNAs [BR:chx03100]  Other eukaryotic RNA   Micro RNA    104797235 (MIR107) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  104797235 miRBase:  MI0030595 LinkDB All DBs Position 26:40101469..40101489 Genome browser NT seq 21 nt NT seq  +upstreamnt  +downstreamnt agcagcattgtacagggctat

DBGET integrated database retrieval system