Ciona intestinalis (yellow sea squirt): 100187689 Help Entry 100187689         miRNA     T01056                                  Symbol mir184 Name (RefSeq) cin-miR-184   KO K17177   microRNA 184 Organism cin  Ciona intestinalis (yellow sea squirt) Brite KEGG Orthology (KO) [BR:cin00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:cin04147]     100187689 (mir184)   09184 RNA family    03100 Non-coding RNAs [BR:cin03100]     100187689 (mir184) Exosome [BR:cin04147]  Exosomal RNA   Exosomal RNA of renal carcinoma cells    100187689 (mir184)   Exosomal RNA of other cancer cells    100187689 (mir184) Non-coding RNAs [BR:cin03100]  Other eukaryotic RNA   Micro RNA    100187689 (mir184) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100187689 Ensembl:  ENSCING00000022309 miRBase:  MI0007173 LinkDB All DBs Position 11:complement(4043118..4043219) Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tggacggagaactgataagggc

DBGET integrated database retrieval system