Cimex lectularius (bed bug): 27787583 Help Entry 27787583          CDS       T05603                                  Symbol ND4L, A7F07_gp04 Name (RefSeq) NADH dehydrogenase subunit 4L   KO K03882   NADH-ubiquinone oxidoreductase chain 4L [EC:7.1.1.2] Organism clec  Cimex lectularius (bed bug) Pathway clec00190   Oxidative phosphorylation clec01100   Metabolic pathways Module clec_M00142   NADH:ubiquinone oxidoreductase, mitochondria Brite KEGG Orthology (KO) [BR:clec00001]  09100 Metabolism   09102 Energy metabolism    00190 Oxidative phosphorylation     27787583 (ND4L)  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03029 Mitochondrial biogenesis [BR:clec03029]     27787583 (ND4L) Enzymes [BR:clec01000]  7. Translocases   7.1  Catalysing the translocation of protons    7.1.1  Linked to oxidoreductase reactions     7.1.1.2  NADH:ubiquinone reductase (H+-translocating)      27787583 (ND4L) Mitochondrial biogenesis [BR:clec03029]  Mitochondrial DNA transcription, translation, and replication factors   Mitochondrial DNA-encoded proteins    Mitochondrial respiratory chain complex I     27787583 (ND4L) BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  Oxidored_q2 Motif Other DBs NCBI-GeneID:  27787583 NCBI-ProteinID:  YP_009250840 UniProt:  A0A342KAD6 LinkDB All DBs Position MT AA seq 84 aa AA seqDB search MSGLFAYCSAYSHLLLMLLSLEYLVLILFLMFFVFFTGLGSGYYFILVFLSFSVCEGVLG LSLLVSLIRCHGNDNLMTMSMLVW NT seq 255 nt NT seq  +upstreamnt  +downstreamnt atatctggtctttttgcttattgtagagcttataggcatttgcttttgatattgttaaga ttggaatatttggttcttattttgtttttaatgttttttgttttttttacagggttagga tctggttattattttattttggtctttttgtctttttctgtttgtgagggggttttgggt ctctctcttttggttagtttaattcgttgtcatggtaacgataatttgataaccatgtcc atgttagtatgataa

DBGET integrated database retrieval system