Nitratidesulfovibrio liaohensis: KPS_001455 Help Entry KPS_001455        CDS       T09362                                  Symbol zapB Name (GenBank) cell division protein ZapB   KO K09892   cell division protein ZapB Organism clih  Nitratidesulfovibrio liaohensis Brite KEGG Orthology (KO) [BR:clih00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:clih03036]     KPS_001455 (zapB) Chromosome and associated proteins [BR:clih03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     KPS_001455 (zapB) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB HALZ Phage_GP20 TSC22 ATP-synt_D FlaC_arch bZIP_1 DUF3972 Tmemb_cc2 APC_N_CC bHLH_IRO3 SoPB_HTH YabA NRBF2 Motif Other DBs NCBI-ProteinID:  WMW66836 LinkDB All DBs Position 1644011..1644247 Genome browser AA seq 78 aa AA seqDB search MELIDLLETRVTALLSQLETLREENSRLREEVEGGLSALAEENRILKEALDGERAVKDAV LTRIDALLLRLKDQTGGA NT seq 237 nt NT seq  +upstreamnt  +downstreamnt atggaactgattgacctgcttgaaacccgcgtcacggcgctcctgtcgcagctcgaaacc ctgcgtgaggagaacagtcgccttcgggaagaggtcgaaggcgggctttcggcgctggcg gaagagaaccgaatcctcaaggaagcccttgacggggagcgcgccgtgaaagatgcggtg cttacgcgcatcgatgcgctgctgctccgcctcaaggaccaaaccggcggcgcctag

DBGET integrated database retrieval system