Campylobacter lari NCTC 11845: UPTC3659_1454 Help Entry UPTC3659_1454     CDS       T03552                                  Symbol hup Name (GenBank) DNA-binding protein HU   KO K03530   DNA-binding protein HU-beta Organism cln  Campylobacter lari NCTC 11845 Brite KEGG Orthology (KO) [BR:cln00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:cln03032]     UPTC3659_1454 (hup)    03036 Chromosome and associated proteins [BR:cln03036]     UPTC3659_1454 (hup)    03400 DNA repair and recombination proteins [BR:cln03400]     UPTC3659_1454 (hup) DNA replication proteins [BR:cln03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     UPTC3659_1454 (hup) Chromosome and associated proteins [BR:cln03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     UPTC3659_1454 (hup) DNA repair and recombination proteins [BR:cln03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       UPTC3659_1454 (hup) BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  Bac_DNA_binding HU-HIG DUF2267 HU-CCDC81_euk_2 HU-CCDC81_bac_2 Motif Other DBs NCBI-ProteinID:  AJD02284 UniProt:  A0A0A8HWP5 LinkDB All DBs Position complement(1463006..1463308) Genome browser AA seq 100 aa AA seqDB search MTKADFISQVAQTAGLTKKDATAATDAVIATITDVLAKGDSISFIGFGTFSVAERAAREA RVPSTGATIKVPATKVAKFKVGKNLKDAVAAAKTAKKAKK NT seq 303 nt NT seq  +upstreamnt  +downstreamnt atgactaaagcagattttatttctcaagttgctcaaactgctgggctaactaaaaaagat gcaactgcagctactgatgcagtaatcgctactatcactgatgtattagctaaaggtgat agcattagctttatcggttttggtacattttctgtagctgaaagagctgctagagaagct agagtaccaagcactggtgctactatcaaagtacctgctactaaagttgctaaatttaaa gtaggtaaaaaccttaaagatgcagttgctgctgctaaaaccgctaaaaaagctaaaaaa taa

DBGET integrated database retrieval system