Canis lupus dingo (dingo): 125753457 Help Entry 125753457         CDS       T08371                                  Name (RefSeq) signal transducer CD24-like   KO K06469   CD24 antigen Organism clud  Canis lupus dingo (dingo) Pathway clud04148   Efferocytosis clud04640   Hematopoietic cell lineage Brite KEGG Orthology (KO) [BR:clud00001]  09140 Cellular Processes   09141 Transport and catabolism    04148 Efferocytosis     125753457  09150 Organismal Systems   09151 Immune system    04640 Hematopoietic cell lineage     125753457  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04090 CD molecules [BR:clud04090]     125753457    00537 Glycosylphosphatidylinositol (GPI)-anchored proteins [BR:clud00537]     125753457 CD molecules [BR:clud04090]  Proteins   125753457 Glycosylphosphatidylinositol (GPI)-anchored proteins [BR:clud00537]  Antigens   125753457 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CD24 Motif Other DBs NCBI-GeneID:  125753457 NCBI-ProteinID:  XP_048956079 UniProt:  A0A8C0KUQ2 LinkDB All DBs Position 23:42326931..42327975 Genome browser AA seq 78 aa AA seqDB search MGRAMVARLGLGLLLLALLLPTQIYSNQTTIVTLSSNSSQSTSTAPNPANTTTTPTGGAL LSTASLFVISFSLLHLYC NT seq 237 nt NT seq  +upstreamnt  +downstreamnt atgggcagagcgatggtggccaggctcggactggggctgctgctcctggcgctgctccta cccacgcagatttattcaaatcaaacaactattgtaacactttcaagtaactcctcccag agtacctcgactgccccaaatccagcaaataccaccaccacaccaactggcggtgctctg ctgtcaacagccagtctcttcgtgatctcattctcccttctacatctctactgttaa

DBGET integrated database retrieval system