Christensenella minuta: B1H56_01330 Help Entry B1H56_01330       CDS       T05665                                  Name (GenBank) ferredoxin family protein   KO K00176   2-oxoglutarate ferredoxin oxidoreductase subunit delta [EC:1.2.7.3] Organism cmiu  Christensenella minuta Pathway cmiu00020   Citrate cycle (TCA cycle) cmiu00720   Other carbon fixation pathways cmiu01100   Metabolic pathways cmiu01110   Biosynthesis of secondary metabolites cmiu01120   Microbial metabolism in diverse environments cmiu01200   Carbon metabolism cmiu01210   2-Oxocarboxylic acid metabolism Brite KEGG Orthology (KO) [BR:cmiu00001]  09100 Metabolism   09101 Carbohydrate metabolism    00020 Citrate cycle (TCA cycle)     B1H56_01330   09102 Energy metabolism    00720 Other carbon fixation pathways     B1H56_01330 Enzymes [BR:cmiu01000]  1. Oxidoreductases   1.2  Acting on the aldehyde or oxo group of donors    1.2.7  With an iron-sulfur protein as acceptor     1.2.7.3  2-oxoglutarate synthase      B1H56_01330 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Fer4 Fer4_7 Fer4_2 Fer4_21 Fer4_10 Fer4_9 Fer4_4 Fer4_6 Fer4_15 LdpA_Fe-S-bd Fer4_16 Fer4_22 Fer4_3 Fer4_13 Fer4_17 Fer4_8 Fer4_18 Motif Other DBs NCBI-ProteinID:  AYH39249 UniProt:  A0A136Q627 LinkDB All DBs Position 272457..272663 Genome browser AA seq 68 aa AA seqDB search MAKLTIYEDTCKGCGLCIGACPKELLAIDKSHLNAKGYHPIGIEHMEDCIGCASCARMCP DCALEVDK NT seq 207 nt NT seq  +upstreamnt  +downstreamnt atggcaaaattaacaatttatgaggatacgtgcaagggctgcggcctgtgcatcggtgcg tgcccgaaggaacttttggcgatcgataaatcgcacctcaatgcgaagggatatcatccg atcgggatcgaacatatggaggactgtatcggctgtgcatcgtgcgcgcgtatgtgcccg gattgtgcgctcgaagtagacaaataa

DBGET integrated database retrieval system