Cupriavidus necator N-1: CNE_BB1p06500 Help Entry CNE_BB1p06500     CDS       T01564                                  Name (GenBank) hypothetical protein   KO K03746   DNA-binding protein H-NS Organism cnc  Cupriavidus necator N-1 Brite KEGG Orthology (KO) [BR:cnc00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:cnc03036]     CNE_BB1p06500    03400 DNA repair and recombination proteins [BR:cnc03400]     CNE_BB1p06500 Chromosome and associated proteins [BR:cnc03036]  Prokaryotic type   Nucleoid associated proteins    HNS (histone-like nucleoid structuring protein)     CNE_BB1p06500 DNA repair and recombination proteins [BR:cnc03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHDIR (short-homology-dependent illegitimate recombination)      Supressor       CNE_BB1p06500 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Histone_HNS PRIMA1 Mito_fiss_reg VIR_N Motif Other DBs NCBI-ProteinID:  AEI82070 UniProt:  F8GXK0 LinkDB All DBs Position BB1p:682241..682462 Genome browser AA seq 73 aa AA seqDB search MADYGLNMEELAAAGCFDPPPPPPPPPPPPPAPAPVVCYRNAAGQSWDGQGEMPDWLRRA VNAGQSKEFYRVG NT seq 222 nt NT seq  +upstreamnt  +downstreamnt atggccgactacgggctgaacatggaggagctggccgcggcggggtgcttcgatccgcca cctcctccgccaccgccgcccccacccccacccgcgccagcgcccgtggtctgctaccgc aacgcggcgggccagagctgggacgggcagggcgagatgcccgactggctgcggcgggcg gtcaatgcggggcagagcaaggagttttaccgggttggatag

DBGET integrated database retrieval system