Coprobacter secundus subsp. similis: Cop2CBH44_07440 Help Entry Cop2CBH44_07440   CDS       T06867                                  Symbol groS Name (GenBank) 10 kDa chaperonin   KO K04078   chaperonin GroES Organism copr  Coprobacter secundus subsp. similis Brite KEGG Orthology (KO) [BR:copr00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03110 Chaperones and folding catalysts [BR:copr03110]     Cop2CBH44_07440 (groS)    03029 Mitochondrial biogenesis [BR:copr03029]     Cop2CBH44_07440 (groS) Chaperones and folding catalysts [BR:copr03110]  Heat shock proteins   HSP10    Cop2CBH44_07440 (groS) Mitochondrial biogenesis [BR:copr03029]  Mitochondrial protein import machinery   Matrix    Other matrix factors     Cop2CBH44_07440 (groS) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Cpn10 Motif Other DBs NCBI-ProteinID:  BCI62391 UniProt:  A0A7G1HV43 LinkDB All DBs Position complement(991377..991646) Genome browser AA seq 89 aa AA seqDB search MNIRPLADRVLIKPAPAEEKTVGGIIIPDSAKEKPLKGEVIAVGNGTKDEEMVVKTGDNV LYGKYAGTEIELDGDKFLIMRQSDILAII NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atgaacattagacctttagcagacagagtgttgatcaaaccggcacctgcagaagaaaaa acagttggaggaattataattcctgattctgcaaaagaaaaacctttaaaaggtgaagta attgccgtaggtaacggaacaaaagatgaagaaatggtcgtaaagacaggagataatgta ctatatggtaaatatgccggtacggaaattgaactggatggagacaaattcctcattatg cgtcaatctgacattttagctattatctaa

DBGET integrated database retrieval system