Corynebacterium suranareeae: N24_1330 Help Entry N24_1330          CDS       T07007                                  Symbol atpE Name (GenBank) ATP synthase F0F1 subunit C   KO K02110   F-type H+-transporting ATPase subunit c Organism csur  Corynebacterium suranareeae Pathway csur00190   Oxidative phosphorylation csur01100   Metabolic pathways Module csur_M00157   F-type ATPase, prokaryotes and chloroplasts Brite KEGG Orthology (KO) [BR:csur00001]  09100 Metabolism   09102 Energy metabolism    00190 Oxidative phosphorylation     N24_1330 (atpE)  09180 Brite Hierarchies   09181 Protein families: metabolism    00194 Photosynthesis proteins [BR:csur00194]     N24_1330 (atpE) Photosynthesis proteins [BR:csur00194]  Photosystem and electron transport system   F-type ATPase [OT]    N24_1330 (atpE) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ATP-synt_C Motif Other DBs NCBI-ProteinID:  BAU95592 UniProt:  A0A169RV33 LinkDB All DBs Position 1421908..1422150 Genome browser AA seq 80 aa AA seqDB search MNEIILAQDATESSITGLGAVGYGIATIGPGLGIGILVGKALEGMARQPEMAGQLRTTMF LGIAFVEALALIGLVAGFLF NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgaacgagatcatcctggcacaggacgcaaccgagtcctccatcaccggccttggcgct gtcggctacggcatcgcaaccatcggacctggcctcggcatcggcatcctggttggtaag gctctcgagggtatggcacgtcagcctgagatggctggacagctccgtaccaccatgttc ctgggcatcgccttcgttgaggccctggcactgatcggccttgttgctggcttcctgttc taa

DBGET integrated database retrieval system