Comamonas terrigena: CT3_29770 Help Entry CT3_29770         CDS       T09012                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism ctez  Comamonas terrigena Brite KEGG Orthology (KO) [BR:ctez00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:ctez03036]     CT3_29770 Chromosome and associated proteins [BR:ctez03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     CT3_29770 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB Cep57_CLD_2 CENPH ATG16 ENOX1 TolA_bind_tri Csm1_N SlyX CCDC106 Taxilin DUF4164 DivIC YabA HalX Motif Other DBs NCBI-ProteinID:  BBL25522 LinkDB All DBs Position 3297260..3297457 Genome browser AA seq 65 aa AA seqDB search MIEPLAERVDRLLLRHAELQRTNALLAEQVAALTQERDSLRSRLQAARARVDALIERLPA NQEAP NT seq 198 nt NT seq  +upstreamnt  +downstreamnt atgatcgagccgctggcagagcgtgttgatcgcctgctgctgcgccacgccgaacttcag cgcaccaatgccctgctggccgagcaggtggccgcgctcacacaggagcgcgattccctg cgctcgcgcctgcaggcggcccgtgcacgggtggacgcactgattgagcgcctgcccgcc aaccaagaggcaccatga

DBGET integrated database retrieval system