Chromobacterium vaccinii: BKX93_10100 Help Entry BKX93_10100       CDS       T04565                                  Name (GenBank) DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism cvc  Chromobacterium vaccinii Brite KEGG Orthology (KO) [BR:cvc00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:cvc03032]     BKX93_10100    03036 Chromosome and associated proteins [BR:cvc03036]     BKX93_10100    03400 DNA repair and recombination proteins [BR:cvc03400]     BKX93_10100 DNA replication proteins [BR:cvc03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     BKX93_10100 Chromosome and associated proteins [BR:cvc03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     BKX93_10100 DNA repair and recombination proteins [BR:cvc03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       BKX93_10100 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG Motif Other DBs NCBI-ProteinID:  AOZ50315 UniProt:  A0A1D9LGF8 LinkDB All DBs Position 2170556..2170825 Genome browser AA seq 89 aa AA seqDB search MTKAELIALLSDKSGLTKADVLRVLGAFDEVLLDTLASNGEISIVAGKFKVKETSARTGR NPKTGETIQIAAKRKVSFVASKQLKDRIA NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atgaccaaagccgaactgattgcccttctctccgacaagtccggcctgaccaaagccgat gtgctgcgcgttctgggcgctttcgacgaagtgctgctggacaccctggccagcaacggc gagatcagcatcgtggccggcaagttcaaggtaaaggaaacctccgcccgcaccggccgc aacccgaagaccggcgaaaccatccagatcgccgccaagcgcaaggtttccttcgtcgcc agcaaacagctgaaagaccgcatcgcctga

DBGET integrated database retrieval system