Dechloromonas aromatica: Daro_2018 Help Entry Daro_2018         CDS       T00259                                  Name (GenBank) Acyl carrier protein (ACP)   KO K02078   acyl carrier protein Organism dar  Dechloromonas aromatica Pathway dar01100   Metabolic pathways dar01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:dar00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Daro_2018    00074 Mycolic acid biosynthesis     Daro_2018   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Daro_2018 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1896 Ribosomal_L50 DUF5783 HLH Motif Other DBs NCBI-ProteinID:  AAZ46763 UniProt:  Q47EG8 LinkDB All DBs Position 2171924..2172160 Genome browser AA seq 78 aa AA seqDB search MDNIVERVKKIVAEQLGVNEADIKNESSFVDDLGADSLDTVELVMALEEEFECEIPDDQA EKITTVQQAVDYILAGKK NT seq 237 nt NT seq  +upstreamnt  +downstreamnt atggataacatcgtagagcgcgtcaaaaagatcgtcgccgaacaactgggcgtgaacgaa gcggacatcaagaacgagtcctcttttgtggatgatctgggcgctgactccctggacacc gtcgagctggtcatggctctggaagaggaattcgagtgcgagattcctgacgaccaggct gagaaaatcaccactgtccagcaggctgtcgattacatcctcgccggcaagaagtaa

DBGET integrated database retrieval system