Candidatus Desulfofervidus auxilii: HS1_000271 Help Entry HS1_000271        CDS       T09963                                  Name (GenBank) DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism daw  Candidatus Desulfofervidus auxilii Brite KEGG Orthology (KO) [BR:daw00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:daw03032]     HS1_000271    03036 Chromosome and associated proteins [BR:daw03036]     HS1_000271    03400 DNA repair and recombination proteins [BR:daw03400]     HS1_000271 DNA replication proteins [BR:daw03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     HS1_000271 Chromosome and associated proteins [BR:daw03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     HS1_000271 DNA repair and recombination proteins [BR:daw03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       HS1_000271 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 Urease_beta Motif Other DBs NCBI-ProteinID:  AMM40077 UniProt:  A0A7U4QIQ0 LinkDB All DBs Position 259788..260057 Genome browser AA seq 89 aa AA seqDB search MTKAELVSRLASKTGAKKVDVEKILTAFLEEAKEILKTEKKLTLTSFGTFRVVERAARAG RNPQTGKPIKIPATKVVRFKPGKELKTMF NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atgaccaaggctgaattagtatcaagattggcaagcaagacaggggcaaaaaaagttgac gtagaaaaaattcttacagcctttttagaagaagccaaagaaattcttaaaacagagaag aagcttactcttacctcttttggtacctttcgggtagtagagagagcagcacgggcaggt agaaatccacaaactggcaaacccatcaaaattcctgctactaaagtagtccgttttaag ccaggaaaagagttaaaaacaatgttttaa

DBGET integrated database retrieval system