Dermacoccus abyssi: FV141_04435 Help Entry FV141_04435       CDS       T06197                                  Name (GenBank) NrdH-redoxin   KO K18917   mycoredoxin [EC:1.20.4.3] Organism day  Dermacoccus abyssi Brite KEGG Orthology (KO) [BR:day00001]  09190 Not Included in Pathway or Brite   09191 Unclassified: metabolism    99980 Enzymes with EC numbers     FV141_04435 Enzymes [BR:day01000]  1. Oxidoreductases   1.20  Acting on phosphorus or arsenic in donors    1.20.4  With disulfide as acceptor     1.20.4.3  mycoredoxin      FV141_04435 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Glutaredoxin GST_N_3 Glrx-like Thioredoxin_3 Motif Other DBs NCBI-ProteinID:  QEH92855 LinkDB All DBs Position 919963..920199 Genome browser AA seq 78 aa AA seqDB search MSDVTIYWRPGCVFCMRLENALGASRNKATWRNIWEDDEAREFIAMVNDGNEVVPTVVID GRPHTNPDPALVARALKG NT seq 237 nt NT seq  +upstreamnt  +downstreamnt atgagtgacgtgacgatctactggcgccccggctgcgtgttctgcatgcgcctggagaac gccctcggcgcgagcaggaacaaggccacctggcgcaacatctgggaggacgacgaggcc cgcgagttcatcgccatggtcaacgacggcaacgaggtcgtgcccaccgtcgtcatcgac ggccgcccccacaccaaccccgaccccgcgctcgtggcgcgtgctctcaagggctga

DBGET integrated database retrieval system