Desulfomicrobium baculatum: Dbac_0941 Help Entry Dbac_0941         CDS       T00963                                  Name (GenBank) Exonuclease VII small subunit   KO K03602   exodeoxyribonuclease VII small subunit [EC:3.1.11.6] Organism dba  Desulfomicrobium baculatum Pathway dba03430   Mismatch repair Brite KEGG Orthology (KO) [BR:dba00001]  09120 Genetic Information Processing   09124 Replication and repair    03430 Mismatch repair     Dbac_0941  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03400 DNA repair and recombination proteins [BR:dba03400]     Dbac_0941 Enzymes [BR:dba01000]  3. Hydrolases   3.1  Acting on ester bonds    3.1.11  Exodeoxyribonucleases producing 5'-phosphomonoesters     3.1.11.6  exodeoxyribonuclease VII      Dbac_0941 DNA repair and recombination proteins [BR:dba03400]  Prokaryotic type   SSBR (single strand breaks repair)    MMR (mismatch excision repair)     DNA exonucleases      Dbac_0941 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Exonuc_VII_S FTA4 Motif Other DBs NCBI-ProteinID:  ACU89056 UniProt:  C7LQ30 LinkDB All DBs Position 1025067..1025297 Genome browser AA seq 76 aa AA seqDB search MAKAQQTFEKRLERVREITALLESGDLPLEQGVKLFQEGVALSKECAAELEQARIIVESA GQESSAQNGMAPGDEA NT seq 231 nt NT seq  +upstreamnt  +downstreamnt atggcaaaagcacaacagactttcgagaaacggctggaacgggtccgtgagatcacggct ctgcttgaaagcggggacctgcccctggagcaaggcgtgaagctttttcaggaaggggtg gctctctccaaagaatgcgcggcggaactggaacaggcccgcatcatcgtcgagagcgcc ggtcaggagtcctcggcccagaacggaatggcacccggagacgaggcatga

DBGET integrated database retrieval system