Dermatophilus congolensis: SAMEA4475696_1551 Help Entry SAMEA4475696_1551 CDS       T05038                                  Symbol acpP Name (GenBank) Acyl carrier protein   KO K02078   acyl carrier protein Organism dco  Dermatophilus congolensis Pathway dco01100   Metabolic pathways dco01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:dco00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     SAMEA4475696_1551 (acpP)    00074 Mycolic acid biosynthesis     SAMEA4475696_1551 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     SAMEA4475696_1551 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Ribosomal_L50 Motif Other DBs NCBI-ProteinID:  SNV22508 UniProt:  A0A239VLL7 LinkDB All DBs Position 1:complement(1759652..1759903) Genome browser AA seq 83 aa AA seqDB search MAATEQEILAGLAEIVNEETGVETSEVEPQKSFTNDLDIDSLSMMTIVVNAEEKFDVRIP DEEVKNLMTVQDAVDFIKIAQSA NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atggcagcgaccgagcaggagatcctcgcgggcctcgccgagatcgtcaacgaggagacc ggcgtcgagacctccgaggtcgagccgcagaaatccttcaccaacgatctggacatcgac tctctctcgatgatgacgatcgtcgtcaacgctgaagagaaattcgatgtgcgtatccct gatgaggaagtgaaaaacctcatgacggttcaggacgcagtggacttcatcaagatcgcc cagagcgcctga

DBGET integrated database retrieval system