Dechloromonas denitrificans: KI615_11790 Help Entry KI615_11790       CDS       T08301                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism dden  Dechloromonas denitrificans Pathway dden01100   Metabolic pathways dden01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:dden00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     KI615_11790 (acpP)    00074 Mycolic acid biosynthesis     KI615_11790 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     KI615_11790 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1896 Ribosomal_L50 DUF5783 Motif Other DBs NCBI-ProteinID:  UCV06120 LinkDB All DBs Position complement(2480298..2480534) Genome browser AA seq 78 aa AA seqDB search MDNIVERVKKIVAEQLGVNEADIKNESSFVDDLGADSLDTVELVMALEEEFECEIPDDQA EKITTVQQAVDFILANKK NT seq 237 nt NT seq  +upstreamnt  +downstreamnt atggataacatcgtagagcgcgtcaagaagatcgtcgccgaacaactgggcgtgaacgaa gcggacatcaagaatgagtcctcctttgtggacgatctgggcgcggattccctggacacc gtcgaactggtcatggcgctggaagaagaattcgagtgcgaaatccctgacgaccaggct gagaagatcaccacggtccagcaggctgtcgatttcatcctcgccaacaaaaaataa

DBGET integrated database retrieval system