Dechloromonas denitrificans: KI615_20910 Help Entry KI615_20910       CDS       T08301                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism dden  Dechloromonas denitrificans Brite KEGG Orthology (KO) [BR:dden00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:dden03036]     KI615_20910 Chromosome and associated proteins [BR:dden03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     KI615_20910 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB TSC22 DUF3450 DAHL NET2A GAS CCDC39 YabA Rab11-FIP3 CENP-F_leu_zip ACBP4_C FlaC_arch bZIP_1 Csm1_N DivIC bZIP_2 APG6_N Motif Other DBs NCBI-ProteinID:  UCV07806 LinkDB All DBs Position complement(4429362..4429559) Genome browser AA seq 65 aa AA seqDB search MNSELEALEAKIEQVVALVHQLRAENEVLKNQIAAAEVERLHLRQTMTLARERLEGVVDK LPEDA NT seq 198 nt NT seq  +upstreamnt  +downstreamnt atgaatagcgaactcgaagcgctggaagccaagattgaacaggtcgtcgccctggttcac cagttgcgcgccgagaatgaggtgctgaagaatcagatcgccgcagccgaagtcgaaagg ttgcatctgcggcagaccatgacgctagcccgcgagcgtctggaaggcgtcgtggacaag ctgccagaggatgcctga

DBGET integrated database retrieval system