Pseudodesulfovibrio indicus: AWY79_11795 Help Entry AWY79_11795       CDS       T04404                                  Name (GenBank) DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism dej  Pseudodesulfovibrio indicus Brite KEGG Orthology (KO) [BR:dej00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:dej03032]     AWY79_11795    03036 Chromosome and associated proteins [BR:dej03036]     AWY79_11795    03400 DNA repair and recombination proteins [BR:dej03400]     AWY79_11795 DNA replication proteins [BR:dej03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     AWY79_11795 Chromosome and associated proteins [BR:dej03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     AWY79_11795 DNA repair and recombination proteins [BR:dej03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       AWY79_11795 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 HU-CCDC81_euk_2 HU-CCDC81_euk_1 RNA_polI_A14 Motif Other DBs NCBI-ProteinID:  AMK11746 UniProt:  A0A126QPQ3 LinkDB All DBs Position 2617498..2617770 Genome browser AA seq 90 aa AA seqDB search MTKAELVVKIAEKANLTKANAERALNAFLETVESTLVAEGKLTLTGFGTFVVELRKARVG RNPRTGLELKIPETKVVKFRPGKILKEAVK NT seq 273 nt NT seq  +upstreamnt  +downstreamnt atgacaaaggctgaattggttgtcaaaatcgcggaaaaggcaaacctgaccaaagcgaat gccgagcgcgctctgaatgcattcctcgaaaccgtcgaaagcaccctcgttgccgagggc aagctgactctgaccggcttcggtaccttcgtcgtggaactccgcaaggctcgcgtgggt cgcaatccccgcaccggcctcgaactgaagattcccgagaccaaggtcgtcaaattccgc cccggcaagatcctcaaggaagccgttaaatag

DBGET integrated database retrieval system