Dehalogenimonas etheniformans: HX448_08450 Help Entry HX448_08450       CDS       T08265                                  Name (GenBank) glutaredoxin family protein   KO K18917   mycoredoxin [EC:1.20.4.3] Organism deth  Dehalogenimonas etheniformans Brite KEGG Orthology (KO) [BR:deth00001]  09190 Not Included in Pathway or Brite   09191 Unclassified: metabolism    99980 Enzymes with EC numbers     HX448_08450 Enzymes [BR:deth01000]  1. Oxidoreductases   1.20  Acting on phosphorus or arsenic in donors    1.20.4  With disulfide as acceptor     1.20.4.3  mycoredoxin      HX448_08450 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Glutaredoxin GST_N_2 GST_N_3 Thioredoxin_2 Thioredoxin_9 TXD17-like_Trx Glrx-like DUF3088 Motif Other DBs NCBI-ProteinID:  QNT76711 LinkDB All DBs Position 1366174..1366416 Genome browser AA seq 80 aa AA seqDB search MADEIIMYGTTWCPDCYRAKSFLNSRGIPFKWIDIATDPAATAEVERINKGNRSVPTIVF PDGSILVEPSNSELEKKLSP NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atggctgacgagattatcatgtacggcactacctggtgccccgattgctaccgggcgaag agcttcctcaacagcaggggaatcccgttcaagtggatcgacatcgccaccgaccccgct gccacagccgaggtggaacgcataaacaagggcaaccgcagcgtacccacgattgtcttt ccggatggctccatcctggttgaaccttctaattcggaattggagaagaaactcagtccc tga

DBGET integrated database retrieval system