Dechloromonas sp. HYN0024: HYN24_07130 Help Entry HYN24_07130       CDS       T05616                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism dey  Dechloromonas sp. HYN0024 Pathway dey01100   Metabolic pathways dey01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:dey00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     HYN24_07130    00074 Mycolic acid biosynthesis     HYN24_07130   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     HYN24_07130 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1896 Ribosomal_L50 DUF5783 Motif Other DBs NCBI-ProteinID:  AXS79810 UniProt:  A0A3B7A4N5 LinkDB All DBs Position 1508180..1508416 Genome browser AA seq 78 aa AA seqDB search MDNIVERVKKIVAEQLGVNEADIKNESSFVDDLGADSLDTVELVMALEEEFECEIPDDQA EKITTVQQAVDFILANKK NT seq 237 nt NT seq  +upstreamnt  +downstreamnt atggataacatcgtagagcgcgtcaagaagatcgtcgccgaacaactgggcgtgaacgaa gcggacatcaagaacgagtcctcttttgtggacgatctgggcgcggattccctggacacc gttgaactggtcatggcactggaagaagagttcgagtgcgaaatccctgacgaccaggct gaaaagatcaccacggtccaacaggctgtcgatttcatcctcgccaacaagaagtaa

DBGET integrated database retrieval system