Dehalogenimonas formicexedens: Dform_01386 Help Entry Dform_01386       CDS       T04654                                  Symbol mrx1 Name (GenBank) mycoredoxin   KO K18917   mycoredoxin [EC:1.20.4.3] Organism dfo  Dehalogenimonas formicexedens Brite KEGG Orthology (KO) [BR:dfo00001]  09190 Not Included in Pathway or Brite   09191 Unclassified: metabolism    99980 Enzymes with EC numbers     Dform_01386 (mrx1) Enzymes [BR:dfo01000]  1. Oxidoreductases   1.20  Acting on phosphorus or arsenic in donors    1.20.4  With disulfide as acceptor     1.20.4.3  mycoredoxin      Dform_01386 (mrx1) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Glutaredoxin GST_N_2 Thioredoxin_2 GST_N_3 Thioredoxin_9 TXD17-like_Trx DUF3088 Glrx-like Motif Other DBs NCBI-ProteinID:  APV44710 UniProt:  A0A1P8F8E6 LinkDB All DBs Position 1321616..1321864 Genome browser AA seq 82 aa AA seqDB search MSEEIIMYGTTWCPDCYRAKSFLKSRGISFKWIDIAVDPAATTEVERINKGNRSVPTIVF PDGSILVEPSNSELEKKLQSGT NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atgtcagaagaaatcataatgtacggcactacctggtgccccgattgctaccgggctaag agtttcctaaaaagcaggggaatttctttcaagtggatcgacatcgccgttgatcctgcc gccacgaccgaagtggaacggattaacaagggcaaccgcagcgtacccacgattgtcttt ccggacggttccatcctcgttgaaccatccaattcggaactggaaaagaagctacagtcc ggaacctga

DBGET integrated database retrieval system