Diaphorobacter sp. JS3050: HND92_06980 Help Entry HND92_06980       CDS       T10221                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism dij  Diaphorobacter sp. JS3050 Brite KEGG Orthology (KO) [BR:dij00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:dij03032]     HND92_06980    03036 Chromosome and associated proteins [BR:dij03036]     HND92_06980    03400 DNA repair and recombination proteins [BR:dij03400]     HND92_06980 DNA replication proteins [BR:dij03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     HND92_06980 Chromosome and associated proteins [BR:dij03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     HND92_06980 DNA repair and recombination proteins [BR:dij03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       HND92_06980 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 HU-CCDC81_euk_1 HU-CCDC81_euk_2 HU-DNA_bdg DUF2530 Motif Other DBs NCBI-ProteinID:  QJY32760 UniProt:  A0A6M6I5D9 LinkDB All DBs Position 1419168..1419440 Genome browser AA seq 90 aa AA seqDB search MNKTELIEHIANNADISKAAAARALESTIEAVKKTLKKGGTVSLVGFGTFAVGKRAARTG RNPRTGATIKIKAAKVPKFRPGKALKDALN NT seq 273 nt NT seq  +upstreamnt  +downstreamnt gtgaataaaaccgaattgattgagcacatcgccaacaacgctgatatctccaaggctgca gctgcgcgcgcactggagtccacgatcgaagcggttaagaagactctcaagaagggcggc acggtgtcgctcgtcggtttcggcacattcgccgtcggcaagcgcgctgcgcgcactggt cgtaatccccgcacgggggctacgattaaaatcaaggctgctaaagttccaaagttccgt ccaggcaaagcactgaaagatgctttgaactga

DBGET integrated database retrieval system