Dyella japonica: HY57_05760 Help Entry HY57_05760        CDS       T03215                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism dja  Dyella japonica Brite KEGG Orthology (KO) [BR:dja00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:dja03036]     HY57_05760 Chromosome and associated proteins [BR:dja03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     HY57_05760 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB TSC22 DUF7491 Mod_r GAS Stathmin YwqH-like YabA Tropomyosin bZIP_2 Syntaxin Taxilin SKA2 DUF2203 Spectrin TMF_TATA_bd Cluap1 COG3_N MbeD_MobD DUF16 DUF2968 UPF0242 EMP24_GP25L DivIC Csm1_N Nuf2_DHR10-like KfrA_N Nup88 APG6_N Motif Other DBs NCBI-ProteinID:  AIF46802 UniProt:  A0A075JZ74 LinkDB All DBs Position complement(1373806..1374012) Genome browser AA seq 68 aa AA seqDB search MKQELAALGEQVDRLLDAVRRLTEENRSLRHSQEQLASERAGLMARNEQARSRVEAMIQR LKALENNG NT seq 207 nt NT seq  +upstreamnt  +downstreamnt gtgaaacaagagcttgcagccctcggtgaacaggtcgaccgactgctcgacgccgtgcgc cgtctcaccgaagaaaaccgtagcctccgccacagccaggagcagctggcgagcgagcgt gccggcctcatggcacgcaacgaacaggcgcgcagccgcgtcgaggcaatgatccagcga ctgaaggcgcttgagaacaatggctga

DBGET integrated database retrieval system